Category Archives: b) Wagtails

Citrine Wagtail calls analysed

The Barry White of Citrine Wags.

This morning (8th November) Phil (who gave it the Barry moniker) and I went to check out Danes Dyke South- to look for the Citrine Wagtail. Last seen two days ago, the tidewrack at South Landing which had provided food for pipits and wagtails including the Citrine had been almost nearly washed away in the windy/ stormy conditions of two days ago. South Dykes, one mile to the west can keep the higher level tide wrack. It had, and there was the Citrine Wagtail.

First winter Citrine Wagtail South Landing, Flamborough, 6th Nov. 2014. Andy Hood

First winter Citrine Wagtail South Landing, Flamborough, 6th Nov. 2014. Andy Hood

There are some curious things about this bird as already covered. In a nutshell it is:

1) Exceptionally late- about the 4th November record in Britain ever

2) It has a distinct orangey bill base- more usually associated with flava wagtails

3) The call seemed odd, deeper and ‘fuller’ than typical Citrine

Late birds often come from further east… There are several potential explanations. The plumage and call are too close to Citrine to me to invoke the hybrid explanation. Normal variation, say a young bird with pale bill base may explain it (though have no data on such young birds)? However my preferred working hypothesis is that it’s from a less well-known breeding population- perhaps further east than our usual records. Intriguingly this record of Citrine Wagtail on Vancouver Island (2nd record for North America) was coincidentally (or not) a vagrant in mid November with similar orangey bill base pattern.

The call really is also definitely unusual. Following the field impression of three of us Flamborough regulars that it sounded a little odd for Citrine (and some friends commenting here on the blog), the sonogram seemed to bear that out. So I asked some Dutch guys who have been looking into the calls of Citrine and eastern flavas for some time. Thanks to Nils van Duivendijk, Sander Bot and especially Dick Groenendijk

Hi Martin,

I just looked through the recording of the Flamborough Citrine Wagtail. I looked at the recording where eight calls can be heard and these calls are all rather low pitched. I compared the calls with some of my own recordings and after some measurements it seems that the Flamborough wagtail called more than 1 kHz lower compared with other recordings of Citrine Wagtail. The average maximum frequency of the Flamborough bird is 6.6 kHz, whereas I am used to see recordings of Citrine Wagtail with maximum frequencies well above 7.5 kHz.

When looking to sonogram structure, this looks OK for me for Citrine. The first ascending part with two very close parallel lines, the length of both legs roughly similar and for most of the eight calls in the recording the rather blunt-tipped ‘n’ shape. Note that the descending second part of the call looks rather solid and that the modulations are only proper visible at the maximum frequency, which also suits Citrine much better compared with an eastern yellow wagtail. The first and to a lesser extend also the fifth flight call looks a bit more pointed (like in Eastern Yellow Wagtail), but I have found some more flight calls of Citrine showing this feature and I think this is best explained by variation.

Although (very) low pitched, structure of the sonograms looks to me pretty good for Citrine Wagtail.

Dick Groenendijk

Citrine Wagtail sonagram 6th Nov 2014 2nd half

 

Have another listen to the call:

 

Citrine Wagtail. Calls of…

… the Flamborough Bird

And I still have some questions. So welcome to some exploring.

Fuller set of photos below (in this previous post). This morning I got one good series of calls recorded.  I found it a little odd. Certainly not western flava. Certainly raspy, but little (strangely) deep sounding. Was I just rusty? I mentioned this to my compatriots. You can listen to the Flamborough birds’ calls here:

Sonagrams (click on images for larger version)

Though some variation in sonogram shape, the steep ascending  first lines are very close together, no introductory dog-leg and overall shape with descending end of call of similar length to start. This creates a rough N shape typical of Citrine- most obvious in shape of 4th and 7th calls below. However…

The bulk of the call is a little lower pitched – around 6kHz rather than 7 kHz of the few Citrine recordings I have checked. Some of the sonograms are a little closer to Eastern taxa but may just be Citrine variation… I will ask folk who know more than me for some input.

These eight calls on the sonograms are the same eight calls you can hear in the recording above.

Citrine Wagtail sonagram 6th Nov 2014

.

Citrine Wagtail sonagram 6th Nov 2014 2nd half

and this is the bird again as photogrpahed by the birds’ finder:

First winter apparent Citrine Wagtail, South Landing, Flamborough 5th November 2014. Andrew Allport

First winter apparent Citrine Wagtail, South Landing, Flamborough 5th November 2014. Andrew Allport

 

Citrine Wagtail at Flamborough

With orangey bill base

Citrine Wagtail AA a

5th November 2014. We’d already had a great mornings’ birding. Nearly 500 Little Auks, Sooty and Manx Shearwaters, a Grey Phalarope, 35 Pomarine Skuas, three diver species, Med Gull, Red-necked Grebe, 6 Velvet Scoter, 2 Asio Owls… An all round air punching seawatch.

Returning for lunch break, just as I was about to head back, Brett Richards rang. The grapevine at Flamborough  was cookin’. Andrew Allport with Ian Marshall had found an interesting wagtail at South Landing, Citrine and Eastern flava were both in the frame initially.

So Phil C. and I were soon on site. Andrew A. gained some superb photos. Andrew A. and I concurred that the bird’s overall appearance and suite of specific character were all much more in favour of Citrine. Specifically pale forehead and lores, big pale ‘C’ around ear coverts, hollowed-out pale ear coverts (especially on upper side with very little dark border); very grey and white plumage with big white wing bars all said Citrine.

Citrine Wagtail AA. j

However…

It had orange at the bill base- a small area at base of upper mandible and about half of lower mandible; not normal for 1cy Citrine. It also had clean white throat, dark retained juvenile ‘necklace’ and notably more ‘sullied’ underparts below the necklace-  the latter less typical for 1cy Citrine. I also noted (with ambivalence) some faint hint of olive tones over the mantle.

What’s the story?

So why does it have these slight and different features, especially the bill base colour (normally all black on Citrine)? This bird was accepted in Sweden as 1cy Citrine (not accepted as specifically pertaining to werae though) has similar bill base colour. It is also a mid November record. Unlike the Flamborough bird it also has an ‘unusual’ head pattern. Not all agree that it is a straightforward Citrine (Magnus Hellström pers. comms.)

All photos of Flamborough bird- thanks to Flamborough doyen, Andrew Allport, video by the legend that is Dave Tucker.

Citrine Wagtail AA. g

 

Citrine Wagtail AA dCitrine Wagtail AA. i

Citrine Wagtail AA e Citrine Wagtail AA. f

To Compare

Typical 1cy Citrine Wagtail from THIS POST

citrine-wagtail-jim-nicholson1

 

1cy Citrine Wagtail with dark lores from THIS POST

12205b-bergeronnette-citrine-compl51

 

Typical 1cy Eastern flava from THIS POST

eyw6

Apparent hybrid Citrine X flava Wagtail from THIS POST

motacilla-flava-vleiland-a-bas-vd-b

and… today’s bird again by Andrew Allport

Citrine Wagtail AA. h

 

Grey-headed Wagtail in first winter plumage

Overlooked thunbergi?

Had this fella in the field west of the lighthouse at Flamborough yesterday. Interesting ID process as I could have easily overlooked it (the photos make it look easier!). As it’s the only report in the U.K. this autumn- just wondering if others are being missed.

Here’s the features:

Reduced supercilium first thing noted- limited essentially to behind eye- and rather thin

Ear coverts looking ‘filled in’ and dark

Greyish bloom to head especially over nape and even onto mantle

Necklace of spots right across the breast

Aged by retained juvenile greater coverts with crisp white fringes contrasting with 2nd generation median coverts with broader yellowy-buff broader more diffuse fringes.

gave only ‘sweet’ western flava type calls (so not plexa)

Perhaps a young male?

Have a look through the photos:

grey headed wag 9

grey headed wag 2grey headed wag 5grey headed wag 8grey headed wag1000.

Citrine Wagtails ‒ how difficult can it be!?

Magnus Hellström

Sexing Citrine Wagtails, it sounds pretty easy, doesn’t it? And yes, typical and representative birds rarely causes any trouble in this respect: Smart looking males with bright and clean lemon head, ear-coverts and breast combined with a well-developed black nape collar signals their gender rather promptly. The same goes for most females showing a duller yellow front with darker olive-greyish crown and ear-coverts and a pale nape.

AGood looking 2cy male with clean yellow head and breast and black nape. Ageing supported by brownish and worn remiges and outer greater coverts. Russia, June. Photo: Magnus Hellström.

BRather typical female (probably adult due to apparently rather fresh and well-kept dark primaries and primary-coverts) showing greyish olive crown and ear-coverts. Russia, June. Photo: Magnus Hellström.

Life would be simple if the issue had stopped there but, rather stimulatingly, it doesn’t. More intermediately patterned individuals are sometimes seen and such birds often causes discussions in the birding community. This challenging problem is caused by the fact that some first summer (2cy) males shows less developed male characters while, conversely, some adult (3cy+) females attain a more colourful and male-like plumage than normally seen. Therefore, if seen under good conditions, there are means to collect further clues: change focus and start with ageing the bird. If 2cy, it is likely that the bird is a dull male, and if 3cy+ we have good reasons to assume it’s a bright female.

CDrab looking (and female-like) 2cy male that sang and held territory for a week. Aged as 2cy by still showing juvenile worn and bleached remiges, primary-coverts, alula and outer greater coverts. Sweden, May. Photo: Göran Bength.

The Citrine Wagtail – like its closest relatives – unfortunately shows a moult pattern where both the young and the adult birds replace their body contour feathers during winter (in a so-called partial pre-breeding moult). This moult does not include remiges, but it does include a number of greater coverts and tertials. This means that more or less all birds (regardless of age) in the spring will exhibit a moult contrast in the wing. Thus, in contrast to many other passerine species, the mere presence of a contrast is of no use for ageing. Instead, concentration should be directed to the parts of the wing that was not replaced during the winter, i.e. primaries and primary-coverts. Both 2cy and 3cy+ birds attained these feathers during the previous summer, but since juvenile feathers are of lower quality than subsequent generations, 2cy birds in the spring will show more worn and brownish primaries and primary-coverts than 3cy+. Mind, however, that also adult birds are getting quite worn by spring, but still usually retains a darker (dark greyish) feather colour. In other words, it is the degree of wear that has to be assessed.

DA rather difficult bird, but although the retained parts of the wing (some tertials, some greater coverts, alula and remiges) has become slightly worn they still give an adult appearance. In my opinion this is most likely a 3cy+ bird and therefore reasonably a female. Russia, June. Photo: Magnus Hellström.

As seen in the photos, Wagtails have a wing structure that often makes primaries and primary-coverts hard to study since they are covered by other feather tracts. This, of course, complicates the situation a bit, and it usually requires good observation conditions to be judged properly. However, the worn and brownish wing in many 2cy birds is often rather eye-catching, and it’s often easier to feel safe ‘nailing’ a 2cy bird than an adult one. In the end, this will probably lead to an over-representation of 2cy being aged (as proportionally more 3cy+ will be left un-aged). This is probably inevitable but can be useful to keep in mind.

EAnother one, giving a slightly sullied impression on crown and ear-coverts and completely lacking black in nape. Retained remiges gives a brownish and worn juvenile impression, and points towards 2cy. Being a 2cy the plumage would favor an ID as a male, and this was also supported by behavior as it defended territory on breeding ground. Mongolia, June. Photo: Magnus Hellström.

FOOTNOTE: If we aim for complete accuracy, the above statement that the presence of a contrast is of no use for ageing, deserves a deeper comment. Adult individuals undergo a complete moult after breeding, and after that the entire plumage is of the same generation. As mentioned above, the partial moult in the following winter creates a simple contrast among the coverts. Nothing strange so far. The juveniles, on the other hand, starts their life with a partial moult soon after fledging, and then, according to the same principles, receives a moult contrast before autumn migration. During winter they, again, conduct a partial moult. Sometimes (but not always) this winter moult include fewer coverts than the previous (post-juvenile) moult. Such a strategy results in a wing with two moult contrasts, since the outermost coverts are still juvenile, the central ones derived from the post-juvenile (summer) moult, and the innermost from the pre-breeding (winter) moult. Establishing three generations of coverts (two moult contrasts) is usually very difficult in field, but if we for some reason manage to do it, it is another good indication of a 2cy bird.

FA rather dark crowned but brightly yellow-faced bird with quite clean ear-coverts. The photo is slightly out of focus and the bird is wet from rain, but wear in primaries supports 3cy+ (and the bird appeared adult also in field). As adult this should be a safe female. Russia, June. Photo: Magnus Hellström.

The Mike Yarwood bird

Even writing that title makes me realise how old I am. For younger readers: Mike Yarwood used to do impressions. I can remember as a small child in the 70s his show was one of my dad’s favourite TV programmes. I was impressed too, even though I was only dimly aware of half the people he ‘did’. I recall that Enoch Powell was a favourite – I assumed he was a cartoon character and couldn’t work out why he never came on after Jackanory. Anyway, I digress. Birds that do impressions: in Shetland there are basically two that are really good at it. The Starling is one and this is the other.

IMG_0978a

Starlings get me going all the time, but when Wheatears first arrive back on territory they can be as good if not better. They do a fantastic Green Sandpiper, and plenty more besides. How long do such birds retain other species’ calls in their repertoire? I’ve often wondered – and maybe there is some good research on the subject out there? For example, the Starlings at the back of our house were doing a very nice Swallow song ten days or so ago – well before the Swallows (which have bred in the sheds out the back for the past two years) arrived back. Those Starlings might have seen the odd Swallow this year before that but I can’t imagine they had heard any singing.

Also at the back of our house, I was pulled up sharp last Wednesday by the call of a Citrine Wagtail. It sounded pitch perfect to me, I was looking round frantically and eventually spotted the source of the calls as a smart drake Wheatear sat on a stone dyke. Where had that bird got the call from? I walked around all the wet bits within a mile of the house and found… three White Wags.

This story has a happy ending however, as the very next day, stepson no. 2 and I were down at the bottom of the garden discussing rhubarb-growing strategies when that Wheatear started calling again – except that this time it was coming from the edge of a sludgy pool in the next field and a quick look revealed:

IMG_2304b

Moral of the tale – always listen to bird mimics, they can be good for your find list!

Confirmed! Tory flava wagtail IS Eastern

Good news for Irish birders (+the rest of us!)

news via:  Aidan Kelly and Martin Collinson

finders: Jim Fitzharris, Jim Dowdall and Victor Caschera

“We got there in the end with the Tory Island Yellow Wag (October 2013) although it was another difficult one. The sample provided by Peter eventually yielded some DNA, and we have been able to get a short sequence (270 bp) of ND2 sequence. Over this stretch, it is 100% identical to multiple Yellow Wag sequences previously obtained from N to NE Siberia (Anabar, Anadyr, Khabarovsk, Cherskiy, also Alaska, NE China and Mongolia) (also 100% identical to the Colyton, Devon bird) and at least 14 bp different from any Western Yellow Wag. This puts it in the ‘northeast’ clade of Yellow Wags i.e. plexa or tschutschensis. It’s not one of the south-eastern ones (macronyx and taivana) as these are 4-5 bp different.

best wishes

Martin Collinson”

Tory Island Yellow Wag EYW02 Oct 13 ND2 partial sequence L5216 Mota5502 GGCAAAACTAATTTTCATCACCAGCCTACTCCTAGGAACCACCATCACTATCTCGAGCAACCACTGAATCATGGCCTGGGCCGGCCTGGAAATTAACACACTAGCCATCCTAC

CACTAATCTCAAAATCCCACCACCCGCGGGCCATTGAAGCTGCCACTAAGTACTTCCTAGTGCAAGCAGCTGCTTCTGCCCTAGTCCTATTCTCCAGTATGACTAACGCATGAT

GTACGGGACAATGGGACATTACCCAACTCACCCACCCAACATC

 reblogged from last autumn:

Tory Island, October 2013

The story is not over yet on this next bird. It has been discussed elsewhere and I agree with sentiments that it really looks the business for an eastern bird, similar to many tschutschensis Eastern Yellow Wagtails. Strikingly the upperpart grey tone looks saturated mostly cold almost blueish grey, the white supercilium while fading towards the bill base is off set by blackish lores (at certain angles). However the only calls which were heard and recorded seem to be ‘sweet’ sounding like western birds, and not raspy like Eastern birds. Some eastern types have been recorded giving both ‘sweet’ and rasping’ calls elsewhere in Europe, so….  The final aspect of this one’s ID may come from DNA if it can be sequenced from the poo samples sent off…

eyw3

eyw6eyw10eyw4

 Grey and white flava showing characters of eastern taxa, perhaps tschutschensis, Tory Island, Co Donegal, October 2013 by Aidan Kelly (thanks Aidan!)

 

by way of comparison

Here are 3 other grey and white looking flava wagtails. Western birds do throw out young grey and white looking birds. However all I have come across seem to usually have warm slight brownish wash to upperparts (not so cold and blueish looking) with less striking wing bars and lack blacker lores and subcoronal marks bordering the upperside of the supercilia- found to varying degrees on seeming eastern birds. The birds below just don’t look rare enough! And when they call, they inevitable give very typical  nice ‘sweet’ western calls.

flava type western Nafcha Negev 8 nov 2013
.flava type b western Nafcha Negev 8 nov 2013
grey and white flava- probably thunbergi, Nafcha, Negev, Israel, November 2013. This was heard to give lovely ‘sweet’ western calls’. Photos MG
thunbergi b dale of walls sept 13
thunbergi dale of walls sept 13
grey and white flava- probably thunbergi, Dale of Walls, Shetland, September 2013. This was also heard to give lovely ‘sweet’ western calls’. Photos MG
flava-wagtail-sumburgh-farm-one
grey-white-flava-rr3grey and white flava- probably nominate flava, Sumburgh, Shetland, October 2011. This was recorded and gave ‘sweet’ western calls’. Upper photo by Mark Payne, lower by Roger Riddington.