Category Archives: b) Wagtails

Confirmed! Tory flava wagtail IS Eastern

Good news for Irish birders (+the rest of us!)

news via:  Aidan Kelly and Martin Collinson

finders: Jim Fitzharris, Jim Dowdall and Victor Caschera

“We got there in the end with the Tory Island Yellow Wag (October 2013) although it was another difficult one. The sample provided by Peter eventually yielded some DNA, and we have been able to get a short sequence (270 bp) of ND2 sequence. Over this stretch, it is 100% identical to multiple Yellow Wag sequences previously obtained from N to NE Siberia (Anabar, Anadyr, Khabarovsk, Cherskiy, also Alaska, NE China and Mongolia) (also 100% identical to the Colyton, Devon bird) and at least 14 bp different from any Western Yellow Wag. This puts it in the ‘northeast’ clade of Yellow Wags i.e. plexa or tschutschensis. It’s not one of the south-eastern ones (macronyx and taivana) as these are 4-5 bp different.

best wishes

Martin Collinson”

Tory Island Yellow Wag EYW02 Oct 13 ND2 partial sequence L5216 Mota5502 GGCAAAACTAATTTTCATCACCAGCCTACTCCTAGGAACCACCATCACTATCTCGAGCAACCACTGAATCATGGCCTGGGCCGGCCTGGAAATTAACACACTAGCCATCCTAC

CACTAATCTCAAAATCCCACCACCCGCGGGCCATTGAAGCTGCCACTAAGTACTTCCTAGTGCAAGCAGCTGCTTCTGCCCTAGTCCTATTCTCCAGTATGACTAACGCATGAT

GTACGGGACAATGGGACATTACCCAACTCACCCACCCAACATC

 reblogged from last autumn:

Tory Island, October 2013

The story is not over yet on this next bird. It has been discussed elsewhere and I agree with sentiments that it really looks the business for an eastern bird, similar to many tschutschensis Eastern Yellow Wagtails. Strikingly the upperpart grey tone looks saturated mostly cold almost blueish grey, the white supercilium while fading towards the bill base is off set by blackish lores (at certain angles). However the only calls which were heard and recorded seem to be ‘sweet’ sounding like western birds, and not raspy like Eastern birds. Some eastern types have been recorded giving both ‘sweet’ and rasping’ calls elsewhere in Europe, so….  The final aspect of this one’s ID may come from DNA if it can be sequenced from the poo samples sent off…

eyw3

eyw6eyw10eyw4

 Grey and white flava showing characters of eastern taxa, perhaps tschutschensis, Tory Island, Co Donegal, October 2013 by Aidan Kelly (thanks Aidan!)

 

by way of comparison

Here are 3 other grey and white looking flava wagtails. Western birds do throw out young grey and white looking birds. However all I have come across seem to usually have warm slight brownish wash to upperparts (not so cold and blueish looking) with less striking wing bars and lack blacker lores and subcoronal marks bordering the upperside of the supercilia- found to varying degrees on seeming eastern birds. The birds below just don’t look rare enough! And when they call, they inevitable give very typical  nice ‘sweet’ western calls.

flava type western Nafcha Negev 8 nov 2013
.flava type b western Nafcha Negev 8 nov 2013
grey and white flava- probably thunbergi, Nafcha, Negev, Israel, November 2013. This was heard to give lovely ‘sweet’ western calls’. Photos MG
thunbergi b dale of walls sept 13
thunbergi dale of walls sept 13
grey and white flava- probably thunbergi, Dale of Walls, Shetland, September 2013. This was also heard to give lovely ‘sweet’ western calls’. Photos MG
flava-wagtail-sumburgh-farm-one
grey-white-flava-rr3grey and white flava- probably nominate flava, Sumburgh, Shetland, October 2011. This was recorded and gave ‘sweet’ western calls’. Upper photo by Mark Payne, lower by Roger Riddington.

 

Eastern flavas in Norfolk and Donegal?

Eccles, Norfolk, October 2013

by Tim Allwood and Andy Kane

'Eastern' Yellow WagtailApparent Eastern flava wagtail, tschutschensis?  Eccles, Norfolk, October 2013. by Neil Bowman

 Hi Martin,
 I recall a few posts of yours on eastern and plexa wags and thought you might like a look at a bird we had in October in Norfolk.
 I was birding my local patch at Eccles, East Norfolk when I heard a strange call in high winds and rain. I initially thought it may have been Richard’s Pipit but the conditions were not conducive to hearing the call with any clarity and I also thought it had some wagtail-like quality. Despite tramping around for a while I couldn’t locate the bird, but Andy Kane found it next morning and on flushing thought it was going to be a Citrine due to its greyness, clear wingbars in flight and sharp, almost buzzy call. However, on the deck views showed it defo wasn’t Citrine (no clear ear covert surround, slight yellow wash on undertail etc). It’s clearly an interesting bird, the call was often sharp and pipit-like with a fizzy or buzzy quality (a sort of “tsseeep!”) and the appearance is highly unusual – we’ve never seen anything like it aside from Phil Heath who saw a similar bird on Shetland many Octobers ago. Despite attempts to record the call a few times on my phone I never got anything satisfactory as it was always windy and despite making recordings they were all too noisy. We were also going to attempt to trap the bird on the first available weekend but were again beaten by conditions and ultimately the departure of the bird!
 The appearance of the bird changed markedly with the prevailing light and cloud cover etc. At times a pale grey and at others a darker grey. Some could see a faint olive tinge on the lower mantle in optimum conditions. The undertail wash also varied in intensity in a similar fashion. I wondered if there may be some thunbergi influence (?) due to the yellowish wash on the undertail and rear flanks, but the head pattern and particularly supercilium, lores and dark supa-loral were very striking, much more so than expected for thunbergi… and the rest of the underparts were very pale off-white to white. Similar looking birds (with a yellow undertail wash can be found wintering in India
 Andy Kane heard the bird the same day and also thought the calls distinctive and thought them pipit or even lark-like. It could occasionally give softer versions of the call, but the loud and striking explosive “tsseeeep” surprised us and wasn’t something we’d heard from a wagtail.
 I have read as much as I can find on wagtail systematics and taxonomy recently, and frankly it’s a minefield as I guess you are well aware! Is there an area where tschutschensis is known to intergrade with thunbergi as suggested by the map in Alstrom et al, so birds could have yellowish wash on undertail but otherwise appear basically grey/white and have eastern-type calls? The bird was present Oct 13th to Oct 23rd and arrived during the weather that brought a Red-flanked bluetail only a mile to the north at Happisburgh and similar vagrants to the rest of the Norfolk coast. However, the area where the bird was is a series of sheep fields that were in use at the time (the sheep were attracting the wagtail in). Although we have negotiated access for a very few of us, the farmer was still not particularly happy with more than a couple of us being in the fields. This fact, combined with wide ditches and wet ground, and the fact that the bird could go missing for long periods made observation difficult.
 Tim Allwood (and Andy Kane)
P1030516 TA

Apparent Eastern flava wagtail, perhaps tschutschensis, Eccles, Norfolk, October 2013. Tim Allwood.

.P1620559 ta.
P1620571 ta

above 2 photos. Apparent Eastern flava wagtail, perhaps tschutschensis, Eccles, Norfolk, October 2013 by Andy Kane

 

More grey and white flavas

by Martin G

Tory Island, October 2013

The story is not over yet on this next bird. A similar bird to the Eccles, Norfolk individual was present on Tory Island, co. Donegal, also in October 2013. It has been discussed elsewhere and I agree with sentiments that it really looks the business for an eastern bird, similar to many tschutschensis Eastern Yellow Wagtails. Strikingly the upperpart grey tone looks saturated mostly cold almost blueish grey, the white supercilium while fading towards the bill base is off set by blackish lores (at certain angles). However the only calls which were heard and recorded seem to be ‘sweet’ sounding like western birds, and not raspy like Eastern birds. Some eastern types have been recorded giving both ‘sweet’ and rasping’ calls elsewhere in Europe, so….  The final aspect of this one’s ID may come from DNA if it can be sequenced from the poo samples sent off…

eyw3

eyw6eyw10eyw4

 Grey and white flava showing characters of eastern taxa, perhaps tschutschensis, Tory Island, Co Donegal, October 2013 by Aidan Kelly (thanks Aidan!)

 

by way of comparison

Here are 3 other grey and white looking flava wagtails. Western birds do throw out young grey and white looking birds. However all I have come across seem to usually have warm slight brownish wash to upperparts (not so cold and blueish looking) with less striking wing bars and lack blacker lores and subcoronal marks bordering the upperside of the supercilia- found to varying degrees on seeming eastern birds. The birds below just don’t look rare enough! And when they call, they inevitable give very typical  nice ‘sweet’ western calls.

flava type western Nafcha Negev 8 nov 2013
.flava type b western Nafcha Negev 8 nov 2013
grey and white flava- probably thunbergi, Nafcha, Negev, Israel, November 2013. This was heard to give lovely ‘sweet’ western calls’. Photos MG
thunbergi b dale of walls sept 13
thunbergi dale of walls sept 13
grey and white flava- probably thunbergi, Dale of Walls, Shetland, September 2013. This was also heard to give lovely ‘sweet’ western calls’. Photos MG
flava-wagtail-sumburgh-farm-one
grey-white-flava-rr3grey and white flava- probably nominate flava, Sumburgh, Shetland, October 2011. This was recorded and gave ‘sweet’ western calls’. Upper photo by Mark Payne, lower by Roger Riddington.

Grey-headed Wagtail ID

Necklaces on females

by Sindre Molværsmyr and M.G. 

It’s long been known that adult male Grey-headed Wagtails (thunbergi) can show variable dark feather across the yellow breast, on some creating something of a little necklaced effect. Females can too. Sindre reports on observations made on breeding birds in Norway, which may be useful in both spring and autumn migrants  and not just of adult males:

“Male thunbergi are usually quite simple to separate from male flava, the females on the other  hand can be a different story. Often they can look surprisingly similar. I
think that dark breast markings can be a way to distinguish some female
thunbergi from flava. At least at summer (when I have the most experience).
Have also seen dark breast markings on thunbergi migrating, so most likely
it can be used all year around. I will not claim that it is a secure ID
criteria, as I haven’t seen enough of either ssp. to do that, but it
should be looked more closely in to.”

IMG_4131Female thunbergi. Though breast centre slightly wind-blown, still dark spots also present in middle of the breast.

Male thunbergi

 Male thunbergi. Males are more variable. This one has dark marking in the breast, but dark markings more randomly placed than in females.

female thunbergi

IMG_4276

above 2: the same female thunbergi in both photos. Old brown feathers in wing should indicate 2cy? Makes me wonder if the breast markings this bird shows are more common in 2cy birds. The bird also lacks yellow tones on flank and undertail.

.

Above, 3 photos of a pale female thunbergi. It’s mate is pictured below.

Gave a quite pale and brown expression in field. On photos one can see yellow tone in rump and on flanks. This one also shows some dark on breast, but more restricted than “normal” thunbergi.

male thunbergi paired to pale female above.

All photos and text above by Sindre Molværsmyr

British or Yellow-headed Yellow Wagtail?

On Helgoland, the British Yellow Wagtail (Motacilla flava flavissima) used to breed in the 1920s and 1930s, but then disappeared due to rats. Since it is a scarce spring migrant with the occasional breeding record (the last in 1977).

On April 17th I was happy to add this taxon (regarded as a species in Germany) to my garden list, when the local sheep broke into the neighbouring garden, followed by a flavissima. The following day, the same happened again and I could see 2 males and a female flavissima as well as a male flava from my kitchen table. Together with Martin Gottschling I went out for photographing these birds and we noticed a Citrine Wagtail like rasping call – THE signal to check any Yellow Wagtail more closely, as there are many vagrant taxa from the south and east using this call. However, the flava male had already disappeared and only the 3 flavissima (2 males and a female) were present. While one male and the female called normally, the other male always used the Citrine Wagtail call, as far as we could see/hear.

Bild

This is the bird in question – looks like flavissima to me!

Bild

Sorry, my sonagram skills are still juvenile …

You can listen to a recording of the call >HERE<

So, could it be a Yellow-headed Yellow Wagtail (Motacilla flava lutea)? This taxon is still on the German list due to 2 records on Helgoland, which were recently rejected by the Helgoland Rarities Committee, as lutea and flavissima are not safely identifiable in the field and no call was recorded. These birds looked like lutea, but such extremes are apparently regularly recorded in the British breeding population of flavissima. So this time, it is the other way around: We have a bird only obvious by the rasping call. By the plumage features, I wouldn’t hesitate to call this bird a flavissima, though perhaps on the brighter side of the majority. However, is the call a safe ID-feature of this taxon?

Checking the literature, I found some hints only:

Alström & Mild (2003): Pipits and Wagtails of Europe, Asia and North America.

p. 281: “… Accordingly, vagrants outside their normal ranges cannot be identified with certainty, except perhaps by voice (see Voice).

p. 300-301: The call of flava, flavissima, beema and thunbergi … given both in flight and from the ground … is a rather loud pseeu, pslie, psie or similar …Also gives a slightly sharper psriee or tsriee (in combination with the above-descibed notes), which is possibly a less harsh variant of the alarm call (but is used as a normal flight-call).

The subspecies lutea apparently uses both ‘feldegg-type’ and ‘flava-type’ calls … We have not heard any lutea that switched between the two call-types (more research on the calls of lutea is needed).

Van Duivendijk (2011); Advanced Bird ID Handbook.

For lutea and flavissima no voice-feature is given, although in other taxa, the rasping call is mentioned in opposite to north-western Yellow Wagtail taxa

So, what does this tell us? Although flava and thunbergi might utter occasionally a harsher call, birds calling constantly like this should be of another taxon. Nevertheless, I think it is very unlikely that lutea and flavissima meet on Helgoland in a flock rather early in the year. A southeastern Yellow Wagtail I would expect to appear rather later in spring, as e.g. feldegg does, although there are some rather early records (e.g. last week). Southwestern vagrant taxa however seem to appear rather early in the year (there were already quite a few observations this spring in southern Germany).

To me this is just a flavissima. But if flavissima can call like this, then Rarities Committees should reconsider, if the call should be really the clincher for the ID of vagrant Yellow Wagtail taxa.

Blues, Reds,Greens

Yellows and Whites

Flamborough 18/19th April

Blue-headed Wagtail b Thornwick 18.4.13

Still lively here. Missed a fly through Alpine Swift  in the morning but was very pleased to find this male Blue-headed Wagtail in the afternoon. It was cavorting with 2 male Yellows, 2 male Whites and several Pied Wagtails. Nearby on a big green patch, 2 orange and greys – proper looking Greenland Wheatears fed. Are they really getting earlier or did we always have them in mid April?

Blue-headed Wagtail f Thornwick 18.4.13
2cy male Blue-headed Wagtail. Think it probably is a 1st summer bird with the partial white throat and rather brownish caste the flight feathers. Some tertial moult going on but not sure what that means. These not easy to age in spring (unless 2 moult limits visible in coverts only found in small percent of 2nd calendar years). Lovely head colour that morphed depending on light from rich  smoky blue to greyer and similarly lores and ear coverts could look same tone or darker blackish-blue. It’s all about the light you know. Call a sweet note typical of flava/flavissima/western thunbergi. Further comments on aging welcome.

Blue-headed Wagtail g Thornwick 18.4.13
both fightMeanwhile bit of scrapping between the migrants and some more wagtails:

White Wagtail 18.4.13 .White Wagtail b 18.4.13 . Pied Wagtail b 18.4.13

Greenland Wheatears. First one around 16th April, then at least half a dozen about on 18th April

2013-04-20_093836

2013-04-20_093917

1st summer male Black Redstart

2 birds at Thorwick last night (19th), one of which was a paradoxus 1st summer male. More on bird trapped at Spurn in similar plumage.

2013-04-19_204737
and from this morning… (20th April)

Early walk got my calling Green Sandpiper and smart male Brambling as new for my little Flamborough patch.

Brambling 20.4.13

Unusual Citrine Wagtail?

In Brittany, France

by Martin and Philippe Dubois

We can get juvenile/ 1st winter Citrine Wagtails pretty much anytime now. Philippe Dubois sent these photos of a 1st winter Citrine Wagtail taken in Brittany, NW France. It was present, 7-10 September, 2011. All photos by Matthieu Canevet.

Notice anything odd?

The lores are really dark looking. Phillipe, Nils van Duivendijk and I chatted about it and we all thought it looked OK still for Citrine, but an odd one. Others thought it wasn’t quite right. Here’s what I wrote:

 “Interesting bird for sure- and I do love these autumn wagtails!
 I think this look like Citrine. All the patterns look fine apart from the dark lores (the whole head seem little dark) I do see some warmth in keeping with Citrine at the bill base and tail length- well the last one I saw in Shetland in this plumage was surprisingly short-tailed looking
(see http://birdingfrontiers.com/2011/12/01/finale-shetland-autumn-2011/ )
 Also with tricky bird nowadays, an ideal extra factor is to also record the call. The sonograms of Citrine and eastern are (usually) distinguishable as I remember.
 This bird  as an example
 http://birdingfrontiers.com/2011/08/25/eastern-yellow-and-citrine-wagtails/
 is more hybrid like and the sonogram was more ‘eastern flava’  than Citrine.

1st winter Citrine Wagtail, NW France, Sept. 2011 all photos by Matthieu Canevet.

Intriguing Yellow Wagtails…..

This post poses more questions than answers, but you’ve gotta love Yellow wagtails :-)

The first bird of interest was photographed recently by Nick Senior at Grafham Water in Cambridgeshire.

Intriguing flava wagtail © Nick Senior

This bird shows grey upper-parts/nape/crown that perhaps could be explained away by individual variation or perhaps that old chestnut ‘within acceptable variation’ (birds similarly plumaged to this are observed most springs) However the wing-bars are possibly not what we would expect to see. They are both broad and distinctively white, reminiscent of those shown by Citrine Wagtail. Can flava Yellow Wagtails show wing-bars like this?

Perhaps as significant is the call. Nick transcribed the call (in his own words) as a bzzslpp’  similar to typical flava though more complex and lower toned with an almost bunting (eg Reed) type quality. A recording of the call could perhaps prove very valuable in untangling the conundrum?

I recently observed another interesting Yellow Wagtail at one of the few regular breeding sites for this species in North Cumbria. This individual showed a grey colouration to the mantle that extended up onto the nape and crown. There also seemed to be contrast between the apparently brighter yellow tones on the face and the more washed out yellow on the breast. The median covert bar also seemed to be bright white and perhaps broader than I expected (though admittedly not particularly obvious in this image)!

interesting Yellow Wagtail © Tristan Reid

My assumption at the time was that this bird was just a variant flavissima, and this may well be correct. However, where does this apparent ‘citrine-esque’ ghosting come from? Is this just variation? Could there some other influences leaking into this species genetics or are these individuals originating from a distinct population?

Toby Collett has observed similar birds to this at the Saltholme RSPB reserve in Cleveland over the previous few years. He has also observed that the calls seem ‘buzzier’ than those of typical flavissima. The following youtube clip recorded by Toby shows a very similar bird to the Cumbrian bird, though perhaps more importantly, you can hear the bird calling.

The call is (to my ear at least) different enough to warrant further analyses; so some recordings of these ‘grey-types’ could be very interesting.

It seems that these grey-types may be a regular feature in the UK, particularly across the east coast of the UK. However it would be interesting to discover more about these birds! It may be that they are just a variant of flavissima, but there could still be lots to learn……