Confirmed! Tory flava wagtail IS Eastern

Good news for Irish birders (+the rest of us!)

news via:  Aidan Kelly and Martin Collinson

finders: Jim Fitzharris, Jim Dowdall and Victor Caschera

“We got there in the end with the Tory Island Yellow Wag (October 2013) although it was another difficult one. The sample provided by Peter eventually yielded some DNA, and we have been able to get a short sequence (270 bp) of ND2 sequence. Over this stretch, it is 100% identical to multiple Yellow Wag sequences previously obtained from N to NE Siberia (Anabar, Anadyr, Khabarovsk, Cherskiy, also Alaska, NE China and Mongolia) (also 100% identical to the Colyton, Devon bird) and at least 14 bp different from any Western Yellow Wag. This puts it in the ‘northeast’ clade of Yellow Wags i.e. plexa or tschutschensis. It’s not one of the south-eastern ones (macronyx and taivana) as these are 4-5 bp different.

best wishes

Martin Collinson”

Tory Island Yellow Wag EYW02 Oct 13 ND2 partial sequence L5216 Mota5502 GGCAAAACTAATTTTCATCACCAGCCTACTCCTAGGAACCACCATCACTATCTCGAGCAACCACTGAATCATGGCCTGGGCCGGCCTGGAAATTAACACACTAGCCATCCTAC

CACTAATCTCAAAATCCCACCACCCGCGGGCCATTGAAGCTGCCACTAAGTACTTCCTAGTGCAAGCAGCTGCTTCTGCCCTAGTCCTATTCTCCAGTATGACTAACGCATGAT

GTACGGGACAATGGGACATTACCCAACTCACCCACCCAACATC

 reblogged from last autumn:

Tory Island, October 2013

The story is not over yet on this next bird. It has been discussed elsewhere and I agree with sentiments that it really looks the business for an eastern bird, similar to many tschutschensis Eastern Yellow Wagtails. Strikingly the upperpart grey tone looks saturated mostly cold almost blueish grey, the white supercilium while fading towards the bill base is off set by blackish lores (at certain angles). However the only calls which were heard and recorded seem to be ‘sweet’ sounding like western birds, and not raspy like Eastern birds. Some eastern types have been recorded giving both ‘sweet’ and rasping’ calls elsewhere in Europe, so….  The final aspect of this one’s ID may come from DNA if it can be sequenced from the poo samples sent off…

eyw3

eyw6eyw10eyw4

 Grey and white flava showing characters of eastern taxa, perhaps tschutschensis, Tory Island, Co Donegal, October 2013 by Aidan Kelly (thanks Aidan!)

 

by way of comparison

Here are 3 other grey and white looking flava wagtails. Western birds do throw out young grey and white looking birds. However all I have come across seem to usually have warm slight brownish wash to upperparts (not so cold and blueish looking) with less striking wing bars and lack blacker lores and subcoronal marks bordering the upperside of the supercilia- found to varying degrees on seeming eastern birds. The birds below just don’t look rare enough! And when they call, they inevitable give very typical  nice ‘sweet’ western calls.

flava type western Nafcha Negev 8 nov 2013
.flava type b western Nafcha Negev 8 nov 2013
grey and white flava– probably thunbergi, Nafcha, Negev, Israel, November 2013. This was heard to give lovely ‘sweet’ western calls’. Photos MG
thunbergi b dale of walls sept 13
thunbergi dale of walls sept 13
grey and white flava- probably thunbergi, Dale of Walls, Shetland, September 2013. This was also heard to give lovely ‘sweet’ western calls’. Photos MG
flava-wagtail-sumburgh-farm-one
grey-white-flava-rr3grey and white flava- probably nominate flava, Sumburgh, Shetland, October 2011. This was recorded and gave ‘sweet’ western calls’. Upper photo by Mark Payne, lower by Roger Riddington.

 

One thought on “Confirmed! Tory flava wagtail IS Eastern

  1. Pingback: Yellow wagtails washing, video | Dear Kitty. Some blog

Leave a Reply